Bacterial genetics

 
Index:

Lambda Red Recombineering for Salmonella

P22 Transduction Protocol

Conjugating plasmids into bacteria

Mariner Transposon Mutagenesis

Lambda Red Recombineering for Salmonella

(Posted by Ingrid S-P)

Link to the Word file

Derived from One-step inactivation of chromosomal genes inEscherichia coli K-12 using PCR products; Kirill A. Datsenko and Barry L. Wanner* PNAS June 6, 2000 vol. 97 no. 126640-6645

Plasmid sequence files; Genebank format.

For Gene Inactivation:

  1. Design primers to generate kanamycin or chloramphenicol cassette amplification that have homology to your gene of interest (GOI).
    1. Sense primer:  40 nt immediately 5’ of your GOI + GTGTAGGCTGGAGCTGCTTC
    2. Antisense primer: 40nt immediately 3’ of your GOI (remember  to REVERSE COMPLEMENT) + CATATGAATATCCTCCTTAG
    3. PCR amplify kanamycin or chloramphenicol cassettes from pKD4 or pKD3, respectively.

PCR protocol (LAMBDAR)

95 3′
95 1′
45 1′
72 2′
GOTO 2 30X
72 10′
12 HOLD

You should see a 1.5 (kan) or 1.2 (chlor) kb band.

  1. Lambda Red Transformation Protocol.
    1. Transform Salmonella with pDK46, grow at 30C
    2. Make overnight 1mL culture at 30C with shaking
    3. sub 1:100 into 25 mL of LB-amp with 0.2% arabinose
    4. Incubate with shaking at 30C until OD reaches 0.6-0.8
    5. Pellet in 50 mL conical on tabletop centrifuge at 4C, 7′, 7000 RPM
    6. Wash in 25 mL ice-cold water
    7. Repeat pellet-wash step (2 water washes total)
    8. Pellet and resuspend in 100 uL water
    9. Electroporate 5 uL cleaned PCR product
    10. Recover with SOC 37C
    11. Plate on selective media
    12. P22 Transduction to move the mutation onto a clean background (never exposed to pKD46)  (see P22 Transduction protocol).

For Chromosomal Mutation or Insertion:

  1. Design primers to generate tetracycline cassette amplification to have homology to region immediately before and after the target site on the chromosome that you want to change.
    1. Sense primer:  40 nt immediately 5’ of your site of interest + TTAAGAACCCACTTTCACA
    2. Antisense primer: 40nt immediately 3’ of your site of interest (remember  to REVERSE COMPLEMENT) + CTAAGCACTTGTCTCCTG
    3. PCR amplification to generate tetracycline cassette.  As template, I use chromosomal DNA prep of a Salmonella strain that already has the tetracycline insert.

PCR Protocol (TETRA)

95 4′
95 60″
50 30″
72 90″
Goto 2 34X
72 7′
12 End

This should generate ~1.8 kb band.

  1. Lambda Red Transformation Protocol.
    1. Transform Salmonella with pDK46, grow at 30C
    2. Make overnight 1mL culture at 30C with shaking
    3. sub 1:100 into 25 mL of LB-amp with 0.2% arabinose
    4. Incubate with shaking at 30C until OD reaches 0.6-0.8
    5. Pellet in 50 mL conical on tabletop centrifuge at 4C, 7′, 7000 RPM
    6. Wash in 25 mL ice-cold water
    7. Repeat pellet-wash step (2 water washes total)
    8. Pellet and resuspend in 100 uL water
    9. Electroporate 10-300 ng PCR product
    10. Recover with SOC 37C
    11. Plate on selective media
    12. P22 Transduction to move the mutation onto a clean background (never exposed to pKD46) (see P22 Transduction protocol).
    13. Transform tet-resistant strain with pKD46 (Salmonella Transformation with Plasmid protocol).
    14. Order oligos that either A) contain your mutation (such as GAG > TAC), or B) to amplify your insertion via PCR.
  1. If A), primers should be roughly 85-mers (40 nt on each side of the mutation), and they should be reverse complements of each other.  In 18 uL dH2O, mix 1 uL of each primer (at 100 uM) in a PCR tube (20 uL total).  Heat primers to 95C in the PCR machine, and then decrease temperature every minute by 5 degrees until 25C to anneal these oligos (PCR Protocol = ANNEAL).
  2. If B), design primers to have 40 nt homology to the site of insertion.  Amplify up the region to be inserted in the PCR.
  3. Lambda Red Transformation Protocol.
    1. Make overnight 1mL culture of tet-resistant Salmonella with pKD46 at 30C with shaking
    2. sub 1:100 into 25 mL of LB-amp with 0.2% arabinose
    3. Incubate with shaking at 30C until OD reaches 0.6-0.8
    4. Pellet in 50 mL conical on tabletop centrifuge at 4C, 7′, 7000 RPM
    5. Wash in 25 mL ice-cold water
    6. Repeat pellet-wash step (2 water washes total)
    7. Pellet and resuspend in 100 uL water
    8. Electroporate 5 uL oligos (for A) or 10-300 ng PCR product (for B)
    9. Recover with SOC 37C
    10. Plate onto tet-sensitive media.  Watch tet-sensitive plates closely: colonies that are sensitive to tet will come up faster than tet-resistant colonies, but tet-resistant colonies do grow.  I usually check plates at about 20-24 hours after plating.

Tet Sensitive Media

Solution A: Into 500 mL dH2O add:

  • 15g   agar
  • 5g   tryptone
  • 5g   yeast extract
  • 50mg   chlorotetracycline (needs to be autoclaved to be activated)

Solution B: Into 500 mL dH2O add:

  • 10g   NaCl
  • 10g   NaH2PO4 * H2O

Mix solutions A + B after autoclaving and add:

  • 5mL   Fusaric Acid (2.4 mg/mL in DMF)
  • 5mL   20mM ZnCl2

Tet Sensitive Media is good for 24hr at RT (Store at 4C a few days).

  1. Restreak onto tet-sensitive media with tet-sensitive and tet-resistant Salmonella controls.
  2. Streak onto LB plates and tet plates to verify loss of tet resistance
  3. Sequence colonies to identify those with desired mutation

 

P22 Transduction Protocol

(Submitted by Ingrid S-P)

Word File link

Phage Storage Buffer

LB with 0.2% glucose and 0.5X E Salts

Lysate Preparation

  1. 1. Run 1mL overnight culture of Salmonella with your mutation of interest (MOI) in LB at 37C with shaking.
  2. 2. Add 2 mL P22HTint phage (from phage stock – should be diluted 1:1000 in Phage Storage Buffer).
  3. 3. Incubate 9 hours – overnight (I just do overnight) at 37C with shaking.
  4. 4. Pellet cells and transfer supernatant to new tube.
  5. 5. Add 500 uL chloroform.  Vortex well.
  6. 6. Pellet chloroform at high speed in tabletop Eppendorf centrifuge.
  7. 7. Remove upper layer to new tube.
  8. 8. This LB contains phage loaded with your MOI.  Dilute 1:1000 into Phage Storage Butter.  Store at 4C indefinitely.

Transduction

  1. 1. Add 50 uL of an overnight culture of Salmonella MOI recipient to 50 uL diluted phage with your MOI (this has always worked for me though some protocols say to mix 1:1 with log phase cells).  Also mix 50 uL overnight Salmonella culture with 50 uL P22 phage (without resistant markers).
  2. 2. Incubate 37C for 30 min or 1 hour at RT.
  3. 3. Plate onto selective media.  You should get about 50 colonies with your MOI, and no colonies on control plates with Salmonella that had been incubated with P22 sans resistant markers.

Clearing of P22

  1. 1. Streak colonies with your MOI onto green plates.  Dark green colony = phage present, white colony = cells do not contain lytic phage.  Restreak white colonies to confirm loss of the lytic phage.
  2. 2. To avoid lysogens, prepare a green plate with a few uL phage P22 strain H5 struck in a line down the center of the plate.
  3. 3. Select a large white colony and streak it on the green plate across the H5 streak.
  4. 4. Those colonies that were infected with the H5 phage after streaking it through (those colonies that turn dark green) don’t have P22 lysogen.  Those colonies that don’t turn dark green are lysogenized with P22.

Conjugating plasmids into bacteria

Tri Parental mating with the Helper plasmid.

The helper plasmid, based on the naturally occurring pRK plasmid contains the genes necessary for encoding conjugation machinery. The machinery is promiscuous. It can transfer origin of transfer (oriT) regions from different plasmid groups.

The donor should contains an oriT. (temperature sensitive origins, or pEX18 plasmids should be kept at appropriate temperatures)

  • Inoculate (i) helper: into Kan plate;(ii) the donor plasmid (into the appropriate antibiotic plate) and the recipient (Salmonella, Pseudomonas…etc).
  • Next day, scrape about a loopful bacteria (about a pepper corn size (no agar pieces).
  • Resuspend in 500ul LB broth, wash once.
  • Resuspend in 100ul LB. Mix all together. Spot 100ul into a very dry LB agar plate. Incubate at 37C or 30C.
  • (for mating in deletion plasmids, once three bacteria are mixed, spin down gently, resuspend in 100ul)

No need to use filters for mating.

After 4-6 hours, if a replicating plasmid is mated in, streak for single colonies. If moving a suicide vector, grow overnight and next day, streak for single colonies on selection plates. The selection plate should kill both the helper and the donor E. coli but not the recipient.

Selection plates:

For Pseudomonas: Use Irgasan (Triclosan) at 25ug/ml final into LB agar containing the appropriate donor selectable antibiotic. Dissolve the powder in 100% alcohol for stocks.

Use minimal media if you need to avoid Irgasan.

E. coli cannot transport glutamate, citrate, and most E. coli have some kind of auxotrophy (thi, leu, pro). So they will die in this media.thi mutation, encoding functions for making Vit B1, is common in lab  E. coli strains (DH5alpha, SM10lambdaPir, MC1061lambdaPir)

  • Autoclave 850ml water and 15g agar, with a stirbar.
  • After cooling down, add the following.
Stock concentration Final concentration For 1 liter
M63 solution 10X 1X 100ml
NaCitrate 1M 20mM 20ml
Mono sodium Glutamate 1M 20mM 20ml
MgCl2 1M 5mM 5ml
FeNH4SO4 100mM 10-100 uM 10- 100ul
Bacto agar 15g
DDW 850ml

This media is also effective for Salmonella SL14028. (use Iron at 10uM).

Diparental mating: Difficult conjugations can be performed by transforming the donor plasmid into E. coli SM10 strain which contains the pRK conjugation apparatus integrated into its chromosome. SM10 is KanR.

Certain P. aeruginosa (eg PAO1), Salmonella and Klebsiella strains presumably contain restriction systems that will severely restrict foreign DNA. In that case, incubate the recipient at 42C for 2 hours to overnight before conjugation.

HK. 2012.

Gene deletion in P. aeruginosa.

  • Clone the flanking DNA into pEX18 plasmid (GentR, TetR or AmpR)
  • Conjugate the suicide pEX18 plasmid into P. aeruginosa (if it is PA01, incubate at 42C overnight before the conjugation)
  • after 6 hours to overnight growth in the LB plate, streak for single colonies in a selection media
  • Inoculate 3 single colonies into 1ml LB broth, shake at 37C for about 4 hours
  • Using a swab, from each tube,  spot into 2 sucrose plate each (6 sucrose plates total). And then streak for many single colonies (aim for lot of single colonies by streaking each quadrant and discarding tips).
  • Incubate at 30C.
  • Next day, tooth pick well separated colonies into Sucrose and the antibiotic selection plate. The desired recombinants are Sucrose resistant and Ab sensitive.
  • Setup 8 colonies (SucR and AbS) from two sucrose plates for colony PCR. check for the deletion.
  • (certain genes will have either plate phenotypes or other functional assays that will aid in recognizing mutants).
  • Freeze the desired recombinant

(Sucrose plates: autoclave 15g of agar, 10g tryptone, 5 g yeast in 850ml water with a stir bar. Dissolve 200g sucrose in total of 500ml of water, filter sterile. Add 150ml of sucrose solution into the autoclaved agar. Dry the plates).

More about Sucrose plates: No salt in the agar. Always incubate at 30C.

SacB gene based counter selection is superior to the Tet based counter selection.

HK 2012.

Mariner Transposon Mutagenesis for Pseudomonas.

Mariner based transposon vectors:

*From Steve Lory’s lab: pBT20, pBT30 and the tetR version of pBT30: pBAM1 (from Simon Dove lab)

*From Fred Ausubel lab: pMAR2XT7 or .

These transposon vectors should be transformed into Escherichia coli SM10 lambda pir strain ( thi thr leu tonA lacY supE recA::RP4-2-Tc::Mu Km λpir). Because all four transposon vectors contain only the pR6K origin, they will only replicate in E. coli strains containing the lambda pir gene

Transposase containing plasmids:

Transposon Plasmid Resistance marker Antibiotic resistance Outword  facing promoter #1 Outword  facing promoter #2 Reference
Himar1 C9 pBT20 aaC1 gentamicin p-tac p-aaC1
Himar1 C9 pBT30 aaC1 gentamicin None None
Himar1 C9 pBAM1 tetA tetracycline None None
Himar1 wt pMAR2xT7 aaC1 gentamicin p-T7 p-T7

For counter selection against the donor E. coli strain, use antimicrobials to kill E. coli. Triclosan (irgasan) at 25 microgram/ml OR chloramphenicol at 20 microgram/ml is used ( wild-type P. aeruginosa is resistant to these). Alternatively, a minimal medium can be used to counterselect the donor SM10 E. coli, which is auxotrophic for leucine, thiamine (vitamin B1) and threonine. E. coli K12 derivatives cannot transport either glutamate or citrate, therefore, VBMM media supplemented with glutamate is an alternative counterselection growth medium choice.

Minimal media : Autoclave 15g of agar in 850ml distilled water with a stir bar. Cool down to 60C and add the following: 100ml of 10X M63 salts, 20ml of 1M sodium succinate, 20ml of 1M glutamate, 5ml 1M magnisium chloride and 1ml of 100mM ferrous ammonium sulfate. Succinate is is the preferred carbon source for Pseudomonads.

Recipient pseudomonas isolates: PA14 and PAK produce 40,000-60,000 cfu mutant libraryafter a two-hour conjugation protocol if approximately 5X10^8 recipient cells and 1X10^9 donor cells are used. A similar protocol using PA01 produces 5-10 fold fewer colonies. Incubating PA01 at 42C overnight will increase recombination frequency of foreign DNA.

Protocol:
Inoculate the donor strain (E. coli SM10-λpir) containing pBT20 series (into AmpR plate) and recipient P. aeruginosa strain into LB plate.

scrape the bacteria from overnight plates and resuspended in 2 ml of LB broth.

Add 10ul of the suspension into 990 PBS and measure the Absorbance at 600nm.

Using following formula and the dilution method, adjust the OD of the two suspensions that are in the microfuge tubes until the host reaches 20 and the donor reaches 40. (It is best to keep your original suspensions at more than 20 and 40 OD 600 units, respectively. If they are lower, add more bacteria).

Use the following equation for the OD adjustment.

Donor: ({(OD600 of culture x 500}/40)500 =“p” (Dilution factor in ul)

Recipient: ({(OD600 of culture x 500}/20)500 =“q” (Dilution factor ul)

Aliquot 500ul of your donor (E.coli) suspension and 500ul recipient (P. aeruginosa) suspension into separate 1.5ml microfuge tubes. Into these, add p microliter volume of LB broth into the donor tube and q microliter volume of LB broth into the recipient tube.

Gently mix and resuspend. The final OD of the recipient and the donor will be 20 and 40. Measure the optical densities of each again to confirm. If they are lower, then add more bacteria to adjust to final OD.

Mix 300ul of donor and recipient each, mix well. Pipet 50ul from this on a dry LB agar plate. Do 10 spots. Incubated for exactly 2 h to prevent progeny formation.

(If you are using triparental mating using the helper plasmid pRK2013 in E. coli HB101, keep the helper:donor:recipient ratio to 40:40:20).

Scrape one entire mating spot into 1XM63 salts, 11ml. For PA14 or PAK, one spot will give 50,000 cfu after 2 hour incubation.  A 150mm petri dish can harbor 2000 cfu that are well separated. Therefore, 25 of these plates are needed with two more additional plates for donor and recipient alone controls.

For PA01, scrape 10 spots in 11ml (this isolate has lower recombination frequency).

350 microlitres from this suspension should be plated on larger diameter petri dishes (diameter 150 mM). The media in the petri dish should contain an agent to select against E. coli (eg:   Irgasan (25 µg ml−1), Chloramphenicol 5µg/ml, or use auxotrophic media to kill E. coli).

Technique of plating: Stack 5 plates (containing glass beads) into one column. Add glass beads. Turn the plates so that agar surfaces are facing up, add 350ml mating mix. Shake the column of plates  until the cultures are dry. Discard the beads.

When the mutants arise after 24 hours, they can be grown in 96 well deepwell plates. Before freezing, take a 50ul aliquots in to 96 well PCR plate for template DNA preparation. Then the cultures are  frozen in 96well deep well plates by adding glycerol. 500ul culture can be grown in 2.2ml deepwell plate (square well) without cross contamination with adjacent wells.

Procedure for sequencing the transposon insertion site

This protocol is designed for mapping transposon insertion junctions in P. aeruginosa chromosome by arbitrary PCR method and then sequencing these PCR products to map the insertion junction.  The “TnM” primers described here are specifically designed for mapping specific TnM-out Mariner insertions. The TnM specific primers must be redesigned for other transposons. The arbitrary primers described here can be used universally in any P. aeruginosa isolate. For additional information see Chun et al, (14). Arbitrary PCR methods for P. aeruginosa are based on this publication.

Preparation of the template chromosomal DNA

Spin down the cultures that were aliquoted into 96 well PCR plates or PCR strip tubes. Resuspend them in 100ul lysis buffer (10mM Tris, pH 8 and 0.05% SDS).

Run the thermocyler’s lysis program (15 min at 98C followed by cooling at 4C).

Pellet cell debris by centrifuging at 4000RPM for 20 minute and remove 50ul of supernatant containing chromosomal DNA into a new plate or tubes. Seal with foil. Store at –20C.

Arbitrary PCR and sequencing transposon junction. (Note that frequently used arbitrary primers in most publications were first described by Chun et al or in O’toole et al)

 Round 1 PCR

Arbitrary primers (for P. aeruginosa genome): There are four arbitrary primers that are used in this step:

Rnd1-ARB1-Pa: 5’-GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG-3’

Rnd1-ARB2-Pa: 5’-GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC-3’

Rnd1-ARB3-Pa: 5’-GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT-3’

Rnd1-ARB4-Pa: 5’-GGCCACGCGTCGACTAGTACSNNNNNNNSNSSSGCG-3’

Transposon specific primer for round 1

BT20 transposon specific primer: Rnd1-TnM20 : 5’-TATAATGTGTGGAATTGTGAGCGG-3’

BTK30 transposon specific primer: Rnd1-TnM30 : 5’-CACCGCTGCGTTCGGTCAAGGTTC-3’

MAR3XT7 transposon-specific primer: Rnd1-TnMAR3X: 5′-TACAGTTTACGAACCGAACAGGC-3′

Compose reactions on ice:

1µl Rnd1-TnM (20pmol/ul)  (Rnd1-TnM20, 30, or Rnd1-TnMAR3X)

1µl Rnd1-ARB (50pmol/ul each) (Note: this could be a single primer or a mixture of  Rnd1 primers).

1µl lysate

2.5 ul 10X Taq PCR buffer

2.5 mM Mg++

0.5 ul DNTP (10mM stock)

1ul DMSO

0.5ul Taq DNA pol

De-ionized water to 25ul.

Note that a higher amount of Rnd1-ARB is used here.

Use the following thermocycler program.

Step 1              94oC    3 min

Step 2              94oC    30 sec

Step 3              49 oC   30 sec *reduce temp by 1 oC for each subsequent round

Step 4              72 oC   3 min

Step 5              Goto Step 2: 15 rounds repeat

Step 6              94 oC   30 sec

Step 7              60 oC   30 sec

Step 8              72 oC   3 min

Step 9              Goto Step 6: 20 rounds repeat

Step 10            12 oC   Hold

Do not clean the PCR reactions from round 1 unless you have a PCR failure during the second round. In that case, cleanup round 1 PCR DNA using the steps outlined in 3.16.3.

Round 2 PCR

Compose reactions on ice:

Round 2 common primer which hybridizes in to round 1 arbitrary primers:

Round 2 common primer: Rnd2-ARB  5’- GGCCACGCGTCGACTAGTAC-3’

Transposon specific primers:

For pBT20 transposon: Rnd2-TnM20   5’- ACAGGAAACAGGACTCTAGAGG-3’ (Kulasekara et al)

For pBTK30 transposon: Rnd2-TnM30: 5’-CGAACCGAACAGGCTTATGTCAATTC-3’ (Goodman et al)

For MAR3XT7  transposon: Rnd2-TnM-MAR3X: (5′-TGTCAACTGGGTTCGTGCCTTCATCCG-3′) (Liberati et al)

Notes: The round 2 common primer Rnd2-ARB was first designed by Chun et al, and referred to as Primer 4 , and appeared as ARB2 in O’toole et al , and as Rnd2-Pa in Kulasekara et al , and as CEKG4 in Jacobs et al, and as ARB2A in Liberati et al. Rnd2-TnM-MAR3X is originally referred as PMFLGM.GB-2a in Liberati et al.

Compose reactions on ice:

1ul Rnd2-TnM (20pmol/ul) (choose the appropriate transposon specific primer).

1ul Rnd2-ARB (20pmol/ul) (the common round 3 primer).

2ul PCR product from Round 1

10 ul 10X Taq PCR buffer

1ul DNTP

2ul DMSO

2  mM Mg++

1ul Taq DNA pol

Deionized water to 50ul

 Use the following thermocycler program.

Step 1              94oC    3 min

Step 2              94oC    30 sec

Step 3              60 oC   30 sec

Step 4              72 oC   2 min

Step 5              Go to Step 2: 30X

Step 6              72oC    5 min

Step 7              12 oC   Hold

Run 5ul of each sample on a 1.5% agarose gel

Round 2 products are often less than 1000 base pairs. You should get no product for parental (negative) control. If you run the round 1 PCR in a gel, you should see a smear or a ladder or a single band.

If an important mutant fails to give a PCR product, isolate genomic DNA using the Qiagen genomic DNA isolation kit and redo the random PCR steps. Use only 10ng purified DNA for PCR reaction.

The starting temperature of the touch down PCR step can be also altered during round 1 if the first round does not generate a PCR product. Start with either higher temperature or lower temperature (18, 19).

If the above procedure fails for an important mutant, digest the genomic DNA of the mutant with a frequent cutting enzyme (that does not cut the transposon) and ligate the cut DNA into a cloning vector and select for transposon encoded antibiotic resistance. Then sequence the plasmid cloning junction.

PCR Cleanup

 If you have only few samples, clean positive reactions using a PCR cleanup kit. Additionally, if you have more than 12 samples, a simpler, cheaper method is given below.

Compose following reaction in a PCR strip tube or PCR plate:

PCR product:  5ul

EXOSAP-IT enzyme mix (USB #78205): 2ul

Note: EXOSAP-IT is a mixture of Exonuclease I and shrimp alkaline phosphatase. The former removes all primers and unannealed single stranded DNA. The latter removes any unincorporated dNTPs.

Seal the tubes or the plate.

Use following thermocycler parameters to run the reaction:

Step 1:  37 degrees     30 minute

Step 2:  80 degrees     20 minute

Step 3:  4 degrees       hold

Sequencing.

Sequencing primers can be added directly into the EXOSAP-IT reaction mix after the step 3.16.3. If a commercial column based kit was used to clean up PCR, add primer to 10ul PCR product.

Add DMSO to 10% for amplification from P. aeruginosa template. Not necessary for bacteria with lower GC content.

Seal the tubes or the plates. Submit for sequencing.

 Sequencing Primers:

For sequencing BT20 transposon junction: BT20TnMSeq: 5’- CACCCAGCTTTCTTGTACAC

For sequencing BT30 transposon junction: BTK30TnMSeq: 5’-TGGTGCTGACCCCGGATGAAG-3’

For sequencing MAR3XT7transposon junction: MAR3XT7-TnmSeq: 5′-GACCGAGATAGGGTTGAGTG-3′

(MAR3XT7-TnmSeq is originally referred to as PMFLGM.GB-4a (10))

Sequencing result analysis:

The sequencing results should be aligned to P. aeruginosa genome sequence using BLAST, or using locally installed DNA analysis software. When analyzing the sequencing results, locate the transposon arm sequence 5,-AGACCGGGGACTTATCAGCCAACCTGTTA-3’ to map the junction. The residues TA demarcate the transposon insertion locus.

Notes on arbitrary PCR:

Publications describing transposon junction sequencing in P. aeruginosa have based their design of arbitrary primer using the protocol published in Chun et al. Because each publication has different names for identical primers, we have made an effort to describe their various names in following table and then assign a uniform nomenclature to them.

Commonly used arbitrary primers used in P. aeruginosa.

Publication Original name New names
Jacobs et al, CEKG2A Rnd1-ARB1-Pa
O’ Toole et al, ARB6 Rnd1-ARB2-Pa, CEKG2B, Rnd1-Pa2
Chun et al Primer 2 Rnd1-ARB3-Pa, ARB1, CEKG2C, Rnd1-Pa1

Rnd1-ARB1-Pa: 5’-GGCCACGCGTCGACTAGTACNNNNNNNNNNAGAG-3’

Rnd1-ARB2-Pa: 5’-GGCCACGCGTCGACTAGTACNNNNNNNNNNACGCC-3’

Rnd1-ARB3-Pa: 5’-GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT-3’

Rnd1-ARB4-Pa: 5’-GGCCACGCGTCGACTAGTACSNNNNNNNSNSSSGCG-3’

Frequency of the 3’ end motifs present in the PA01 genome (in both strands) for each arbitrary primer.

Rnd1-ARB1-Pa: 12,447

Rnd1-ARB2-Pa: 31,119

Rnd1-ARB3-Pa: 4,212

Rnd1-ARB4-Pa: 50,000

In our hand, Rnd1-ARB1-Pa, one of the primers used to sequence PA01 mutant library, is a reliable primer for arbitrary PCR . If a PCR product is not generated using ARB1-Pa, try using Rnd1-ARB2-Pa, which have more binding sites in the chromosome . On the other hand, a mixture of Rnd1-ARB1, 2 and 3 can be used during the first round. ARB3-Pa, a popular primer that appeared in many publications , only binds to 4212 sites in P. aeruginosa chromosome. This is not surprising because it was first designed for amplifying yeast DNA using arbitrary PCR. In our hand, this primer is good for about 70% of the time (figure obtained from sequencing 600 mutants). Additionally, Rnd1-ARB3-Pa has cold spots (no primer binding sites) in long stretches of DNA some reaching up to 20kbp. The 3’ end of the Rnd1-ARB3-Pa, GATAT, with 40% GC approximately present every 600 bp of the yeast chromosome. Chun et al, designed this 3’ end sequence assuming that it will occur at least once in every 1.5 kb segment with an 90% chance and in a 1 kb segment with an 80% chance in the yeast genome. Therefore, there is no basis for using this primer for amplifying P. aeruginosa chromosome because such distribution does not occur in that genome. Similar rationale should be used for designing new arbitrary primers for any genome.

The randomized portion and the 5’ end of the arbitrary primers used here were first described in Chun et al, . The basis of choosing 10 residues  for randomizing the Rnd1-ARB primers is unknown but this number has been proven successful in creating large mutant banks . If the randomized portion is made of all Gs and Cs, together with the 3’ end of ARB1 primer, then the melting temperature will be 58C. If the randomized portion is made of all As and Ts, then it will be 28C for ARB1 primer. But if the randomized portion is about 64% GC, then the melting temperature will be 49C (melting temperatures were calculated using the Sci tools at the IDT website- http://www.idtdna.com/scitools/scitools.aspx). During Round 1 PCR, annealing temperature 49C was chosen so that it is more biased toward high GC templates found in P. aeruginosa. A 15 round touch down will additionally ensure that correct annealing temperature is reached for each arbitrary primer. The 5’ end of the primers, the sequence GGCCACGCGTCGACTAGTAC was first appeared in Chun et al . It has a melting temperature of 60C with 65% GC rich, indicating that it is suitable for PCR conditions suitable for P. aeruginosa genome, although it was originally designed by Chun et al for amplifying lower GC yeast DNA. The 5’ sequence does not have secondary structures with unfavorable parameters such as stemloops or homodimers.  This sequence will be the scaffold for the Rnd2-ARB primer during the second round. Therefore, when designing new arbitrary primers, it is wise to include these practically proven primer sequences.

References:

Kulasekara HD, Ventre I, Kulasekara BR, Lazdunski A, Filloux A, Lory S. A novel two-component system controls the expression of Pseudomonas aeruginosa fimbrial cup genes. Mol Microbiol. 2005;55(2):368-80. (description of pBT20)

Jacobs MA, Alwood A, Thaipisuttikul I, Spencer D, Haugen E, Ernst S, et al. Comprehensive transposon mutant library of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A. 2003;100(24):14339-44. PMCID: 283593.

Wong SM, Mekalanos JJ. Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A. 2000;97(18):10191-6. PMCID: 27802.

Rubin EJ, Akerley BJ, Novik VN, Lampe DJ, Husson RN, Mekalanos JJ. In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria. Proc Natl Acad Sci U S A. 1999;96(4):1645-50. PMCID: 15546.

Lampe DJ, Akerley BJ, Rubin EJ, Mekalanos JJ, Robertson HM. Hyperactive transposase mutants of the Himar1 mariner transposon. Proc Natl Acad Sci U S A. 1999;96(20):11428-33. PMCID: 18050.

Held K, Ramage E, Jacobs M, Gallagher L, Manoil C. Sequence-Verified Two-Allele Transposon Mutant Library for Pseudomonas aeruginosa PAO1. J Bacteriol. Liberati NT, Urbach JM, Miyata S, Lee DG, Drenkard E, Wu G, et al. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci U S A. 2006;103(8):2833-8. PMCID: 1413827.

Chun KT, Edenberg HJ, Kelley MR, Goebl MG. Rapid amplification of uncharacterized transposon-tagged DNA sequences from genomic DNA. Yeast. 1997;13(3):233-40. (the widely cited paper describing arbitrary PCR)

O’Toole GA, Kolter R. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol. 1998;28(3):449-61.

Goodman AL, Kulasekara B, Rietsch A, Boyd D, Smith RS, Lory S. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev Cell. 2004;7(5):745-54. (description of pBT30)

Liberati NT, Urbach JM, Miyata S, Lee DG, Drenkard E, Wu G, et al. An ordered, nonredundant library of Pseudomonas aeruginosa strain PA14 transposon insertion mutants. Proc Natl Acad Sci U S A. 2006;103(8):2833-8. PMCID: 1413827.  (description of pMAR2xT7)